You are here: Home » Murder/Mystery

Murder/Mystery

Murder/Mystery 7951 to 7973 of 7973 First | Previous | 262 | 263 | 264 | 265 | 266 | Next | Last
Magnify Big Sister
Big Sister

Big Sister


Category: Books
Description: Recently widowed and caring for his young son, Andy Boyd thinks his life is over, until he meets the beautiful, enigmatic Anna. And that was his first mistake ... A startling, emotive and stark psychological thriller from one of Scotland's bestselling crime writers... ' A stark, gripping storyline' Scots ' Strong female characters, honest, pithy dialogue and ever-present empathy for the victims make this a deeply satisfying read' Sunday Times ' Vivid, visceral and compulsive' Ian Rankin _________________ Some secrets should never be kept... Andy Boyd thinks he is the luckiest man alive. Widowed with a young child, after his wife dies in childbirth, he is certain that he will never again experience true love. Then he meets Anna. Feisty, fun and beautiful, she's his perfect match ... and she loves his son like he is her own. When Andy ends up in the hospital on his wedding night, he receives his first clue that Anna is not all that she seems. Desperate for that happy-ever-after, he ignores it. A dangerous mistake that could cost him everything. A brave, deeply moving, page-turning psychological thriller, A Suitable Lie marks a stunning departure for one of Scotland's finest crime writers, exploring the lengths people will go to hide their deepest secrets, even if it kills them... _________________ ' Malone tackles the taboo subject of female violence against men with insight and compassion (for Anna is no one-dimensional witch), while creating all the hallmarks of a fine, page-turning psychological thriller' Daily Mail ' A mystery involving some disturbing account anomalies at Andy's bank is appropriately overshadowed by Malone's painful depiction of a man in turmoil' Publishers Weekly ' It's a tough high-wire act, balancing believability with surprise, but the author pulls it off with aplomb. Excellent stuff' Doug Johnstone, The Big Issue ' Disturbing but compulsive ... I loved it' Martina Cole ' Bristling with unease, this is domestic noir at its very darkest, twisting the marriage thriller into a new and troubling shape' Eva Dolan ' A deeply personal thriller that will keep the reader turning those pages, with twists and turns designed to keep the heart pumping' Russel D. Mc Lean ' A tightly wound page-turner with real emotional punch' Rod Reynolds ' A dark and unnerving psychological thriller that draws you deep into the lives of the characters and refuse to let go' Caroline Mitchell ' A chilling tale of the unexpected that journeys right into the dark heart of domesticity' Marnie Riches ' Emotionally intelligent and engaging' Caro Ramsay ' A story that I won't forget in a hurry. Malone is a massive talent' Luca Veste ' A disturbing and realistic portrayal of domestic noir with a twist ... a shocking yet compelling read' Mel Sherratt ' Malone perfectly balances storytelling with a brutal commentary on a dysfunctional relationship' Sarah Ward
Delivery cost: 0.00
ISBN: 9781912374199
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781912374199
 
£8.99
 
Shop best deal
Magnify A Suitable Lie
A Suitable Lie

A Suitable Lie


Category: Books
Description: Recently widowed and caring for his young son, Andy Boyd thinks his life is over, until he meets the beautiful, enigmatic Anna. And that was his first mistake ... A startling, emotive and stark psychological thriller from one of Scotland's bestselling crime writers... ' A stark, gripping storyline' Scots ' Strong female characters, honest, pithy dialogue and ever-present empathy for the victims make this a deeply satisfying read' Sunday Times ' Vivid, visceral and compulsive' Ian Rankin _________________ Some secrets should never be kept... Andy Boyd thinks he is the luckiest man alive. Widowed with a young child, after his wife dies in childbirth, he is certain that he will never again experience true love. Then he meets Anna. Feisty, fun and beautiful, she's his perfect match ... and she loves his son like he is her own. When Andy ends up in the hospital on his wedding night, he receives his first clue that Anna is not all that she seems. Desperate for that happy-ever-after, he ignores it. A dangerous mistake that could cost him everything. A brave, deeply moving, page-turning psychological thriller, A Suitable Lie marks a stunning departure for one of Scotland's finest crime writers, exploring the lengths people will go to hide their deepest secrets, even if it kills them... _________________ ' Malone tackles the taboo subject of female violence against men with insight and compassion (for Anna is no one-dimensional witch), while creating all the hallmarks of a fine, page-turning psychological thriller' Daily Mail ' A mystery involving some disturbing account anomalies at Andy's bank is appropriately overshadowed by Malone's painful depiction of a man in turmoil' Publishers Weekly ' It's a tough high-wire act, balancing believability with surprise, but the author pulls it off with aplomb. Excellent stuff' Doug Johnstone, The Big Issue ' Disturbing but compulsive ... I loved it' Martina Cole ' Bristling with unease, this is domestic noir at its very darkest, twisting the marriage thriller into a new and troubling shape' Eva Dolan ' A deeply personal thriller that will keep the reader turning those pages, with twists and turns designed to keep the heart pumping' Russel D. Mc Lean ' A tightly wound page-turner with real emotional punch' Rod Reynolds ' A dark and unnerving psychological thriller that draws you deep into the lives of the characters and refuse to let go' Caroline Mitchell ' A chilling tale of the unexpected that journeys right into the dark heart of domesticity' Marnie Riches ' Emotionally intelligent and engaging' Caro Ramsay ' A story that I won't forget in a hurry. Malone is a massive talent' Luca Veste ' A disturbing and realistic portrayal of domestic noir with a twist ... a shocking yet compelling read' Mel Sherratt ' Malone perfectly balances storytelling with a brutal commentary on a dysfunctional relationship' Sarah Ward
Delivery cost: 0.00
ISBN: 9781910633496
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781910633496
 
£8.99
 
Shop best deal
Magnify The Ends Of The Earth
The Ends Of The Earth

The Ends Of The Earth


Category: Books
Description: The breathtaking new novel from the author of The Silent Treatment - for fans of Jojo Moyes, Joanna Cannon and Ruth Jones. Mary O' Connor has been keeping a vigil for her first love for the past seven years. Every evening without fail, Mary arrives at Ealing Broadway station and sets herself up among the commuters. In her hands Mary holds a sign which bears the words: ' Come Home Jim.' Call her mad, call her a nuisance, call her a drain on society - Mary isn't going anywhere. That is, until an unexpected call turns her world on its head. In spite of all her efforts, Mary can no longer find the strength to hold herself together. She must finally face what happened all those years ago, and answer the question - where on earth is Jim?___________________________ PRAISE FOR ABBIE GREAVES:' A remarkable debut' JOJO MOYES' It's beautiful, so moving and clever. I truly adored it.' JOSIE SILVER' An original and moving debut from a talented new voice.' SANTA MONTEFIORE' This is an extraordinarily tense yet tender portrait of a marriage ... written with assurance and agonising insight, and the characters of Maggie and Frank will stay with me for a long time' Daily Mail' Beautifully written in Greaves's unique voice... Poignant, heart-breaking and insightful.' Woman & Home' A must read' Sunday Express' Heart-breaking secrets tenderly evoked with intelligence and depth. Maggie and Frank are unforgettable characters' RACHEL HORE, author of The Memory Garden' Empathetic, beautifully written ... will resonate with fans of Jojo Moyes, David Nicholls and Gail Honeyman.' Daily Express' I adored this powerful, heart-breaking tale' The Sun' Such stunning prose, and such insight for a debut author... I was bowled over by Abbie's writing.' CLARE MACKINTOSH' A beautifully written and compelling novel that enthralled us from beginning to end. Frank and Maggie feel so real, and their moving story is simple, but powerfully told.' Heat When a debut is praised by the likes of Jojo Moyes, you know it's worth reading ... You won't be able to put down this tender and heartbreaking read.' Cosmopolitan' An unforgettable love story with a mystery that had me captivated until the last, heart-wrenching page. It deserves to be huge' CATHERINE ISAAC, author of You Me Everything' Greaves's insightful account of a long marriage kept us gripped till the very last page' Independent' Beautifully written... Poignant, heart-breaking and insightful.' Woman' A tender, heartfelt portrayal of a long marriage with all its secrets. Cleverly structured and beautifully written, this novel celebrates love, hope - and the importance of finding the right words.' LUCY DIAMOND' In her tremendously moving debut, a novel that pulses with emotional tension, Abbie Greaves masterfully unpicks a history of ordinary lives facing extraordinary challenges. I found it impossible to look away from the relationship at the heart of this novel.' GILLY MACMILLAN, author of The Nanny' I really loved it... It's a very moving book' JO WILEY
Delivery cost: 0.00
ISBN: 9781529123968
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781529123968
 
£12.99
 
Shop best deal
Magnify Lying In Wait
Lying In Wait

Lying In Wait


Category: Books
Description: Sunday Times Top 10 Bestseller!' My husband did not mean to kill Annie Doyle, but the lying tramp deserved it.'____________ Lydia Fitzsimons lives in the perfect house with her adoring husband and beloved son. There is just one thing Lydia yearns for to make her perfect life complete, though the last thing she expects is that pursuing it will lead to murder. However, needs must - because nothing can stop this mother from getting what she wants...____________' What an extraordinary novel ... crackles and snaps like a bonfire on a winter's night; you shudder even as you draw closer to it. Spellbinding.' A J Finn, bestselling author of The Woman in the Window' Gone Girl fans will love Liz Nugent's Lying in Wait ... it twists, it turns, its characters are utterly despicable and it is a compulsive triumph' Stylist' A stunningly talented writer' Sophie Hannah' Devastating ... exquisitely uncomfortable, utterly captivating' Publishers Weekly' The intricate plotting and jolting suspense hold you in a vice till the last page' Sunday Times' Clear your diary if you pick up this seductively sinister story. The twists come together in a superbly scary denouncement which delivers a final sting in the tail. Brilliantly macabre' Sunday Mirror' Brilliant plotting ratchets up the tension in this chilling tale of obsessive love, madness and motherhood' Woman & Home' The wit is sharp and the plot full of punishing twists' The Times Crime Club' An unputdownable psychological thriller with an ending that lingers long after turning the final page' Irish Times' Lydia is a Gothic villain for the ages ... a page-turner chock full of lies and betrayals' Kirkus Reviews' An excellent example of Domestic Noir ... excitement and curiosity mount until you realise you can't put the book down. Highly recommended' Literary Review' A tense, taut, almost gothic thriller where the tension tightens to near unbearable proportions ... impossible to stop reading. A brilliantly written, stand-out novel' Marian Keyes' Deliciously twisted ... truly chilling' Sarah Hilary' Liz Nugent's characters are as unforgettably monstrous as they are believable. A superbly crafted novel and an absorbing portrait of the purest kind of evil' Jane Casey' It spoils nothing to tell you now that Lydia and Andrew Fitzsimons have murdered a young prostitute. Read this dark, captivating psychological thriller to find out why' People Magazine' I thought it impossible to match the brilliant Unravelling Oliver, but this Liz has done. Not only is her style beautiful, but she keeps the reader on the edge of their seat from page one until the completely unexpected ending. I read Lying in Wait in one sitting. I just couldn't bear the suspense. I absolutely loved it' Amanda Redman' She writes compellingly, creates posh sociopaths like no-one else and doesn't flinch when the end demands what it demands. Lying In Wait is a story you genuinely should not miss' Rick O' Shea, RTE
Delivery cost: 0.00
ISBN: 9780241974063
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9780241974063
 
£8.99
 
Shop best deal
Magnify The Big Chill
The Big Chill

The Big Chill


Category: Books
Description: Running private investigator and funeral home businesses means trouble is never far away, and the Skelf women take on their most perplexing, chilling cases yet in book two of the darkly funny, devastatingly tense and addictive new Skelfs series! ' Compelling, compassionate ... just brilliant. This series gets better with every book. I cannot get enough of the Skelfs' Mark Billingham ' Confirms the Skelfs as a classic crime clan. I can't wait for the next one' Erin Kelly ' I LOVE the Skelfs ... The only problem with The Big Chill is that you'll devour it so fast you'll feel as bereft as one of the Skelfs' clients ... Doug Johnstone has murdered sleep' Val Mc Dermid Haunted by their past, the Skelf women are hoping for a quieter life. But running both a funeral directors' and a private investigation business means trouble is never far away, and when a car crashes into the open grave at a funeral that matriarch Dorothy is conducting, she can't help looking into the dead driver's shadowy life. While Dorothy uncovers a dark truth at the heart of Edinburgh society, her daughter Jenny and granddaughter Hannah have their own struggles. Jenny's ex-husband Craig is making plans that could shatter the Skelf women's lives, and the increasingly obsessive Hannah has formed a friendship with an elderly professor that is fast turning deadly. But something even more sinister emerges when a drumming student of Dorothy's disappears and suspicion falls on her parents. The Skelf women find themselves sucked into an unbearable darkness - but could the real threat be to themselves? Following three women as they deal with the dead, help the living and find out who they are in the process, The Big Chill follows A Dark Matter, book one in the Skelfs series, which reboots the classic PI novel while asking the big existential questions, all with a big dose of pitch-black humour. ' Emotionally complex, richly layered and darkly funny. An addictive blend of Case Histories and Six Feet Under' Chris Brookmyre ' Brilliantly drawn and blackly comic' Herald Scotland ' Johnstone's intuitive depiction of this trinity of resilient women is never less than flawless, in this tale punctuated by emotional depth and moments of dark humour...' Raven Crime Reads Praise for The Skelfs series *** Longlisted for the Mc Ilvanney Prize for Best Scottish Crime Book of the Year*** ' An engrossing and beautifully written tale that bears all the Doug Johnstone hallmarks in its warmth and darkly comic undertones' Herald Scotland ' Gripping and blackly humorous' Observer ' This dark but touching thriller makes for a thoroughly enjoyable slice of Edinburgh noir' Mary Paulson- Ellis ' This enjoyable mystery is also a touching and often funny portrayal of grief, as the three tough but tender main characters pick up the pieces and carry on: more, please' Guardian ' A tense ride strong, believable characters' Kerry Hudson, Big Issue ' They are all wonderful characters: flawed, funny, brave and well set up for a series. I wouldn't call him cosy, but there's warmth to Johnstone's writing' Sunday Times
Delivery cost: 0.00
ISBN: 9781913193348
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781913193348
 
£7.49
 
Shop best deal
Magnify Cage
Cage

Cage


Category: Books
Description: Drugs, smuggling, big money and political intrigue in Iceland rally with love, passion, murder and betrayal until the winner takes all ... in the masterful, explosive conclusion to the award-winning Reykjavik Noir trilogy... *** Guardian Book of the Year*** *** WINNER of the Best Icelandic Crime Novel of the Year*** ' Tough, uncompromising and unsettling' Val Mc Dermid ' One of the darkest and most compelling series in modern crime fiction ... Tackling topical issues, the book will tell you a great deal about why the world's in the state it is, while never neglecting its duty to entertain' Sunday Express ' A tense thriller with a highly unusual plot and interesting characters' The Times _________________ The prison doors slam shut behind Agla, when her sentence ends, but her lover Sonja is not there to meet her. As a group of foreign businessmen tries to draw Agla into an ingenious fraud that stretches from Iceland around the world, Agla and her former nemesis, Maria find the stakes being raised at a terrifying speed. Ruthless drug baron Ingimar will stop at nothing to protect his empire, but he has no idea about the powder keg he is sitting on in his own home. At the same time, a deadly threat to Sonya and her family brings her from London back to Iceland, where she needs to settle scores with longstanding adversaries if she wants to stay alive... _________________ Praise for the Reykjavik Noir Trilogy: ' Cage is the muted and more credible conclusion to a wayward, but diverting trilogy that began with Snare (2017) and continued with Trap (2018) - ironic titles for essentially escapist fiction ... Compassion beats complexity every time' The Times ' In keeping with a lot of Icelandic fiction, Cage is written in a clean, understated style, the author letting the reader put together the emotional beats and plot developments. Smart writing with a strongly beating heart' Big Issue ' Deftly plotted though and with a forensic attention to the technicalities of stock exchange manipulations and drug running techniques' Crime Time ' With shocks and surprises in store, and that oh so satisfying end, Cage provoked, chilled, and thrilled me' Love Reading ' A novel about survival, about scheming, it's about self-preservation and about clinging to a vestige of decency in a screwed up world. Superbly translated by Quentin Bates, who knows the language, the country, the people and crime writing intimately. Cage is a pacy thriller; you will find yourself invested in the story' New Books Magazine ' An emotional suspense rollercoaster on a par with The Firm, as desperate, resourceful, profoundly lovable characters scheme against impossible odds' Alexandra Sokoloff ' Clear your diary. As soon as you begin reading ... you won't be able to stop until the final page' Michael Wood ' Zips along, with tension building and building ... thoroughly recommend' James Oswald ' The intricate plot is breathtakingly original, with many twists and turns you never see coming. Thriller of the year' New York Journal of Books
Delivery cost: 0.00
ISBN: 9781912374496
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781912374496
 
£8.99
 
Shop best deal
Magnify Creation
Creation

Creation


Category: Books
Description: Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.' Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.' A superbly written explanation' Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.' The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph' One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer' The perfect primer on the past and future of DNA' Guardian' Susenseful, erudite and thrilling' Prospect' A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain' This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili' A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times' Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' Popular Science.co.uk' In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts' An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome' I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell ( BBC4), The Gene Code ( BBC4), Horizon: ' Playing God' ( BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Delivery cost: 0.00
ISBN: 9780241954690
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9780241954690
 
£9.99
 
Shop best deal
Magnify Block 46
Block 46

Block 46


Category: Books
Description: The hunt for a serial killer takes criminal profiler Emily Roys and true-crime writer Alexis Castells from London to Sweden, and back into the past, to Buchenwald Concentration Camp, in the first instalment an addictive, award-winning new series from the Queen of French Noir *** Winner of Balai de la Decouverte and Nouvelle Plume d' Argent Awards*** *** International Number One Bestseller*** ' Dark, oppressive and bloody, but it's also thought-provoking, compelling and very moving' Metro ' Gustawsson's writing is so vivid, it's electrifying. Utterly compelling' Peter James ' A bold and intelligent read' Laura Wilson, Guardian ___________________ Evil remembers... Falkenberg, Sweden. The mutilated body of talented young jewellery designer, Linnea Blix, is found in a snow-swept marina. Hampstead Heath, London. The body of a young boy is discovered with similar wounds to Linnea's. Buchenwald Concentration Camp, 1944. In the midst of the hell of the Holocaust, Erich Hebner will do anything to see himself as a human again. Are the two murders the work of a serial killer, and how are they connected to shocking events at Buchenwald? Emily Roy, a profiler on loan to Scotland Yard from the Canadian Royal Mounted Police, joins up with Linnea's friend, French true-crime writer Alexis Castells, to investigate the puzzling case. They travel between Sweden and London, and then deep into the past, as a startling and terrifying connection comes to light. ___________________ ' A terrific, original duo' The Times ' Multi-layered, superbly plotted, brimming with mystery, tension and bone-chilling violence, and with two very different - but equally fascinating - lead female characters, Block 46 is not for the squeamish or faint-hearted ... this is a book that has the power to shock and the artistry to impress long after the last page has turned' Lancashire Post ' Utterly compelling' Woman's Own ' A bold and audacious debut from a very talented writer. Heralds the beginning of a thrilling new series' R J Ellory ' Viscerally brutal yet delicately beautiful, like blood spatter on fresh snow. An unbelievable debut' Matt Wesolowski ' A truly unique and chilling blend of Nordic Noir's dark atmosphere ... gritty, bone-chilling, and harrowing - it's not for the faint of heart, and not to be missed' Crime by the Book ' A real page-turner, I loved it' Martina Cole ' A great serial-killer thriller with a nice twist ... first rate' James Oswald ' Cleverly plotted, simply excellent' Ragnar Jonasson ' A must-read' Daily Express ' There's a touch of Hannibal Lector in this one, and the final plot twists are harsh and sudden. You'll want to double check the door locks and keep a few extra lights on, as you read ... the suspense is brutal' Kingdom Books
Delivery cost: 0.00
ISBN: 9781910633700
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781910633700
 
£8.99
 
Shop best deal
Magnify Darth Paper Strikes Back
Darth Paper Strikes Back

Darth Paper Strikes Back


Category: Books
Description: The hilarious, clever, and much-anticipated follow-up to the breakout hit, The Strange Case of Origami Yoda! It is a dark time at Ralph Mc Quarrie Middle School. After suffering several Origami Yoda-related humiliations, Harvey manages to get Dwight suspended from school for being a troublemaker. Origami Yoda pleads with Tommy and Kellen to save Dwight by making a new case file-one that will show how Dwight's presence benefits Mc Quarrie. With the help of their friends, Tommy and Kellen record cases such as Origami Yoda and the Pre-eaten Wiener, Origami Yoda and the Exploding Pizza Bagels, and Origami Yoda and Wonderland: The Musical. But Harvey and his Darth Paper puppet have a secret plan that could make Dwight's suspension permanent . . . This is the second case file in the blockbuster bestselling Origami Yoda series, written by Tom Angleberger, author of Star Wars: Return of the Jedi: Beware the Power of the Dark Side, showcasing his proven knack for authentically capturing the intrigues, fads, and dramas of middle school in a satisfying tale of friendship and just resistance to authority ( Kirkus Reviews, starred review). Praise for Darth Paper Strikes Back STARRED REIVEWAngleberger's just-as-funny follow-up to The Strange Case of Origami Yoda delves deeper into the mystery of the helpful paper Yoda in a satisfying tale of friendship and just resistance to authority. Pitch-perfect middle-school milieu and enough Star Wars references (and laughs) to satisfy fans and win new ones.- Kirkus Reviews, starred review In this imaginative sequel...author Tom Angleberger has his finger puppet squarely on the erratic pulse of middle-school life, with its shifting allegiances, squeals, moans and misgivings.- Washington Post As with this story's predecessor, the well-observed middle-school dynamics (and Angleberger's sharp sense of humor) are greatly amplified by the book's design, which includes faux wrinkled pages, abundant doodles, and other scrawled marginalia. It's a natural step up from the Wimpy Kid series, with more text and narrative complexity, but just as much on-target humor and all-around fun. - Publishers Weekly This book is honest, funny, and immensely entertaining. The illustrations and design will engage readers. Based on the positive reception Origami Yoda has received, kids will be clamoring for this sequel. They won't be disappointed. - School Library Journal The Force is with Tom Angleberger in this sequel to his funny and clever novel/comics hybrid, The Strange Case of Origami Yoda. A sequel to equal the funny and clever novel/comics debut of the Origami Yoda, as Dwight's friends try to save him from reform school.- Shelf Awareness With the same deft touch that made The Strange Case of Origami Yoda a pleasure, Angleberger takes readers through the ups and downs of adolescence. - Portland Book Review Darth Paper offers further proof that Angleberger really understands middle-schoolers and the daily dramas that engulf them, while still finding the humor inherent in their situations.- Scripps News
Delivery cost: 0.00
ISBN: 9781419701276
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781419701276
 
£5.99
 
Shop best deal
Magnify The Missing Pieces Of Nancy Moon: Escape To The Riviera For The Most Irresistible Read Of 2020
The Missing Pieces Of Nancy Moon: Escape To The Riviera For The Most Irresistible Read Of 2020

The Missing Pieces Of Nancy Moon: Escape To The Riviera For The Most Irresistible Read Of 2020


Category: Books
Description: ' An engaging novel, strong on character and place, that kept me wanting to know more' Daily Mail' I felt so passionately involved in Flo's journey. A GORGEOUS read' Prima, BOOK OF THE MONTH ' Wonderful. This book is a joy' Katie Fforde, Sunday Times bestselling author ' A lovely read, with the descriptions of the 60s jet-set particularly evocative' Heat' A gorgeous, tender debut' Kate Riordan, author of THE HEATWAVEIf you love taking a journey with the novels of Kristin Hannah or Kathryn Hughes, this novel is for you. To unravel that long-lost summer, she had to follow the thread... Florence Connelly is broken hearted. Her marriage has collapsed under the weight of the loss she shares with her husband, and her beloved grandmother has just died. Even the joy she found in dressmaking is gone. But things change when Flo opens a box of vintage 1960s dress patterns found inside her grandmother's wardrobe. Inside each pattern packet is a fabric swatch, a postcard from Europe and a photograph of a mysterious young woman, Nancy Moon, wearing the hand-made dress. Flo discovers that Nancy was a distant relation who took the boat train to Paris in 1962 and never returned. With no one to stay home for, Flo decides to follow Nancy's thread. She unravels an untold story of love and loss in her family's past. And begins to stitch the pieces of her own life back together.' Moving, hopeful and heartfelt' Felicity Hayes- Mc Coy, author of THE LIBRARY AT THE EDGE OF THE WORLD' Warm and true... Pays tribute to the heart and backbone of women who support each other when the world turns its back' Stephanie Butland, author of LOST FOR WORDS' Two captivating stories of love and heartbreak, stitched together by a trail through Europe in 1962' Gill Paul, author of THE SECRET WIFE' Beautiful and touching. A remarkable debut novel, which demonstrates the enduring nature of love, family and friendship' Sarah Haywood, author of THE CACTUS' A lovely, heartfelt debut. Gave me the most enormous emotional hug' Love Reading READERS ARE LOVING THE MISSING PIECES OF NANCY MOON:' Outstandingly beautiful. This book took my breath away. A sheer joy'' OMG WHAT A BOOK. Fabulously, beautifully written book. It definitely kept me hooked. Nancy Moon's story is full of everything - love, heartache and loss' ' One of the best books I have read this year. It has it all - love, mystery, deceit and a secret. Five stars all the way' ' A wonderful book, which took me on a journey and stayed with me for days afterwards'' A captivating read of secrets untold. A moving story which I read in one day. Many twists and turns enhanced this gripping novel and kept me enthralled' ' I loved this story of love, friendship and hope. Sewing, fashion and 1960s European hotspots. It's perfect'' A lovely, uplifting book. Love how it takes you back to find out clues about her grandmother's life'' I loved the concept, recreating the dresses and travelling across Europe to fill in the blanks'' A charming book that is ultimately about family, friendship and a need to belong'
Delivery cost: 0.00
ISBN: 9781472270092
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781472270092
 
£8.99
 
Shop best deal
Magnify We Shall Inherit The Wind
We Shall Inherit The Wind

We Shall Inherit The Wind


Category: Books
Description: Varg Veum takes on the perplexing case of a missing wind-farm inspector and gets more than he bargained for, as religious zealots, environmental terrorism and then murder take centre stage ... The gripping next instalment in the award-winning Varg Veum series, by one of the fathers of Nordic Noir. ' Not many books hook you in the first chapter - this one did, and never let go!' Mari Hannah ' Mature and captivating' Rosemary Goring, Herald Scotland ' Moving, uncompromising' Publishers Weekly _________________ 1998. Varg Veum sits by the hospital bedside of his long-term girlfriend Karin, whose life-threatening injuries provide a deeply painful reminder of the mistakes he's made. Investigating the seemingly innocent disappearance of a wind-farm inspector, Varg Veum is thrust into one of the most challenging cases of his career, riddled with conflicts, environmental terrorism, religious fanaticism, unsolved mysteries and dubious business ethics. Then, in one of the most heart-stopping scenes in crime fiction, the first body appears... A chilling, timeless story of love, revenge and desire, We Shall Inherit the Wind deftly weaves contemporary issues with a stunning plot that will leave you gripped to the final page. This is Staalesen at his most thrilling, thought-provoking best. _________________ Praise for Gunnar Staalesen ' There is a world-weary existential sadness that hangs over his central detective. The prose is stripped back and simple ... deep emotion bubbling under the surface - the real turmoil of the characters' lives just under the surface for the reader to intuit, rather than have it spelled out for them' Doug Johnstone, The Big Issue ' Gunnar Staalesen is one of my very favourite Scandinavian authors. Operating out of Bergen in Norway, his private eye, Varg Veum, is a complex but engaging anti-hero. Varg means wolf in Norwegian, and this is a series with very sharp teeth' Ian Rankin ' Staalesen continually reminds us he is one of the finest of Nordic novelists' Financial Times ' Chilling and perilous results - all told in a pleasingly dry style' Sunday Times ' Staalesen does a masterful job of exposing the worst of Norwegian society in this highly disturbing entry' Publishers Weekly ' The Varg Veum series is more concerned with character and motivation than spectacle, and it's in the quieter scenes that the real drama lies' Herald Scotland ' Every inch the equal of his Nordic confreres Henning Mankell and Jo Nesbo' Independent' With an expositional style that is all but invisible, Staalesen masterfully compels us from the first pages ... If you're a fan of Varg Veum, this is not to be missed, and if you're new to the series, this is one of the best ones. You're encouraged to jump right in, even if the Norwegian names can be a bit confusing to follow' Crime Fiction Lover ' With short, smart, darkly punchy chapters Wolves at the Door is a provocative and gripping read' Love Reading ' Haunting, dark and totally noir, a great read' New Books Magazine ' An upmarket Philip Marlowe' Maxim Jakubowski, The Bookseller ' Razor-edged Scandinavian crime fiction at its finest' Quentin Bates
Delivery cost: 0.00
ISBN: 9781910633076
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781910633076
 
£8.99
 
Shop best deal
Magnify The Man Who Died
The Man Who Died

The Man Who Died


Category: Books
Description: When Finnish mushroom entrepreneur Jaakko discovers that he has been slowly poisoned, he sets out to find his would-be murderer ... with dark and hilarious results. The critically acclaimed standalone thriller from the King of Helsinki Noir... *** Shortlisted for the Petrona Award for Best Scandinavian Crime Novel of the Year*** *** Shortlisted for the Crime Fest Last Laugh Award*** ' Right up there with the best' Times Literary Supplement ' Deftly plotted, poignant and perceptive in its wry reflections on mortality and very funny' Irish Times ' Told in a darkly funny, deadpan style ... The result is a rollercoaster read in which the farce has some serious and surprisingly philosophical underpinnings' Guardian ------------------------------------- A successful entrepreneur in the mushroom industry, Jaakko Kaunismaa is a man in his prime. At just thirty-seven years of age, he is shocked when his doctor tells him that he's dying. What's more, the cause is discovered to be prolonged exposure to toxins; in other words, someone has slowly but surely been poisoning him. Determined to find out who wants him dead, Jaakko embarks on a suspenseful rollercoaster journey full of unusual characters, bizarre situations and unexpected twists. With a nod to Fargo and the best elements of the Scandinavian noir tradition, The Man Who Died is a page-turning thriller brimming with the blackest comedy surrounding life and death, and love and betrayal, marking a stunning new departure for the King of Helsinki Noir. ------------------------------------ ' The deadpan icy sensibility of Nordic noir is combined here with warm-blooded, often surreal, humour. Like the death cap mushroom, Tuomainen's dark story manages to be as delicious as it is toxic' Sunday Express ' An offbeat jewel ... relentlessly funny' Don Crinklaw, Publishers Weekly ' A bizarre, twisty, darkly comic novel about a man investigating his own murder ... a tightly paced Scandinavian thriller with a wicked sense of humour' Foreword Reviews ' Smart, sensitive, and engaging, and guaranteed to be unlike anything else in your crime fiction library ... the perfect blend of thrills, investigation, character development, and comedy' Crime by the Book ' Hugely entertaining and satisfying ... like Carl Hiassen transported to Finland. It's full of black comedy and has an unlikely hero in Jaakko, who you'll root for to the very end' Kevin Wignall, author of A Death in Sweden ' A delightful mad caper of a story, which will make readers snort out loud with laughter and would have made an excellent 1930s screwball comedy directed by Frank Capra' Crime Fiction Lover ' Combines a startlingly clever opening, a neat line in dark humour and a unique Scandinavian sensibility. A fresh and witty read' Chris Ewan, author of Safe House ' Dark and thrilling, funny and intelligent, this Fargo-like novel contains lethal doses of humour ... and mushrooms' Sofi Oksanen, author of Purge ' A book I will never forget' Matt Wesolowski ' This one is a winner right from the first sentence' Booklist ' Antti Tuomainen is a wonderful writer, whose characters, plots and atmosphere are masterfully drawn' Yrsa Sigurdardottir ' An original and darkly funny thriller with a Coen Brothers-esque feel & tremendous style' Eva Dolan
Delivery cost: 0.00
ISBN: 9781910633847
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781910633847
 
£8.99
 
Shop best deal
Magnify Loves Executioner
Loves Executioner

Loves Executioner


Category: Books
Description: Love's Executioner offers us the humane and extraordinary insight of renowned psychiatrist Irvin D. Yalom into the lives of ten of his patients - and through them into the minds of us all Why was Saul tormented by three unopened letters from Stockholm? What made Thelma spend her whole life raking over a long-past love affair? How did Carlos's macho fantasies help him deal with terminal cancer? In this engrossing book, Irvin Yalom gives detailed and deeply affecting accounts of his work with these and seven other patients. Deep down, all of them were suffering from the basic human anxieties - isolation, fear of death or freedom, a sense of the meaninglessness of life - that none of us can escape completely. And yet, as the case histories make touchingly clear, it is only by facing such anxieties head on that we can hope to come to terms with them and develop. Throughout, Dr Jalom remains refreshingly frank about his own errors and prejudices; his book provides a rare glimpse into the consulting room of a master therapist. Reviews:' Dr Yalom demonstrates once again that in the right hands, the stuff of therapy has the interest of the richest and most inventive fiction' Eva Hoffman, New York Times' These remarkably moving and instructive tales of the psychiatric encounter bring the reader into novel territories of the mind - and the landscape is truly unforgettable' Maggie Scarf' Love's Executioner is one of those rare books that suggests both the mystery and the poetry of the psychotherapeutic process. The best therapists are at least partly poets. With this riveting and beautifully written book, Irvin Yalom has joined their ranks' Erica Jong' Inspired ... He writes with the narrative wit of O. Henry and the earthy humor of Isaac Bashevis Singer' San Francisco Chronicle' Dr Yalom offers a valuable insight into the delicate process of therapy' Sunday Telegraph' Irvin Yalom writes like an angel about the devils that besiege us' Rollo May' These stories are wonderful. They make us realize that within every human being lie the pain and the beauty that make life worthwhile' Bernie S. Siegel' Dr Yalom is unusually honest, both with his patients and about himself' Anthony Storr' Yalom is a gifted storyteller, and from the sound of these tales, a no-less-gifted psychotherapist' Los Angeles Times' This is an impressive transformation of clinical experience into literature. Dr Yalom's case histories are more gripping than 98 percent of the fiction published today, and he has gone to amazing lengths of honesty to depict himself as a realistic flesh-and-blood character: funny, flawed, perverse, and, above all, understanding' Phillip Lopate' I loved Love's Executioner. Dr Yalom has learned something that fiction writers learned years ago - that people's mistakes are a lot more interesting than their triumphs' Joanne Greenberg About the author: Irvin D. Yalom is Professor Emeritus of Psychiatry at the Stanford University School of Medicine. As well as an award-winning psychiatrist and psychotherapist, he is an extremely prolific author. His many other works include The Gift of Therapy, Staring at the Sun, When Nietzsche Wept, The Theory and Practice of Group Psychiatry, The Schopenhauer Cure, Lying on the Couch, Momma and the Meaning of Life, Existential Psychotherapy, I'm Calling the Police, Inpatient Group Psychotherapy, Every Day Gets a Little Closer and The Spinoza Problem.
Delivery cost: 0.00
ISBN: 9780141975443
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9780141975443
 
£9.99
 
Shop best deal
Magnify The final Solution In Riga
The final Solution In Riga

The final Solution In Riga


Category: Books
Description: With its ...[over thousand] detailed and expansive footnotes drawing on twenty-four different archive collections in eight countries and three continents and an enormous secondary literature, this is one of the best researched regional studies of the Holocaust ever to appear. It is helped by the fact that the authors are also always so cognizant of what was happening elsewhere in Europe at the same time and thus frequently draw out the relationship between seemingly haphazard local decisions and trends across Europe... Indeed, the way in which the book 'makes sense' of complex institutional behavior is at times breathtaking... The precision in the detail and the scope of the contextualization make this one of the more important works to appear on the Holocaust in recent years. * English Historical Review This very readable and well documented study fills an important gap in the Holocaust literature: it offers insight into the microcosm reflecting the entire terrifying and murderous scenario of the SS State. * Frankfurter Allgemeine Zeitung [ This] excellent study of the Riga ghetto, informed by Eastern European sources and available now in English translation, provides a precise and ghastly description of what [the liquidation] meant for the local Jews. With laudable thoroughness, they describe the organized shooting of Jews, the first form of industrial-scale mass murder. * The New York Review of Books Ghetto, forced labor camp, concentration camp: All of the elements of the National Socialists' policies of annihilation were to be found in Riga. This first analysis of the Riga ghetto and the nearby camps of Salaspils and Jungfernhof addresses all aspects of German occupation policy during the Second World War. Drawing upon a broad array of sources that includes previously inaccessible Soviet archives, postwar criminal investigations, and trial records of alleged perpetrators, and the records of the Society of Survivors of the Riga Ghetto, the authors have produced an in-depth study of the Riga ghetto that never loses sight of the Latvian capital's place within the overall design of Nazi policy and the all-of- Europe dimension of the Holocaust. Andrej Angrick, a native of Berlin, is a historian, consultant, and researcher affiliated with the Hamburg Foundation for the Promotion of Science and Culture. He has published numerous articles about the Holocaust in the Soviet Union and co-edited Der Dienstkalender Heinrich Himmlers 1941/42 (1999) and Die Gestapo nach 1945: Karrieren, Konflikte, Konstruktionen (with Klaus- Michael Mallmann, 2009), as well as Besatzungspolitik und Massenmord: Die Einsatzgruppe D in der sudlichen Sowjetunion 1941-1943 (2003). Peter Klein, a Berlin-based historian, consultant, and researcher affiliated with the Hamburg Foundation for the Promotion of Science and Culture, has published widely on the Holocaust and German occupation in various parts of central and eastern Europe during the Second World War. Klein was the editor of Die Einsatzgruppen in der besetzten Sowjetunion 1941/1942 (1997) and a co-editor of Der Dienstkalender Heinrich Himmlers 1941/42 (1999). He is the author of Gettoverwaltung Litzmannstadt (2009). Ray Brandon is a freelance translator, historian, and researcher based in Berlin. A former editor at the Frankfurter Allgemeine Zeitung, English Edition, he is co-editor, with Wendy Lower, of The Shoah in Ukraine: History, Testimony, Memorialization.
Delivery cost: 0.00
ISBN: 9780857456014
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9780857456014
 
£27.95
 
Shop best deal
Magnify Overkill
Overkill

Overkill


Category: Books
Description: When the body of a young mother is found on the banks of New Zealand's Mataura River, young female police constable Sam Shephard begins an investigation, with horrifying and very personal implications. Book one in an addictive, atmospheric new series. *** SHORTLISTED for the CWA John Creasey ( New Blood) Dagger 2019*** *** SHORTLISTED for the Ngaio Marsh Award*** ' The tensions within a tightknit village, along with various aspects of Kiwi society, are laid out with real authority, but it is Symon's copper Sam, self-deprecating and very human, who represents the writer's real achievement' Guardian ' Lively evocation of small-town life, with a plot that grabs the reader's attention with a heart-stopping opening and doesn't let go' The Times ' An achievement that blends heart-stopping thrills with deep, believable characters in a stark New Zealand setting. It will leave readers reaching for the next Sam Shephard mystery' Foreword Reviews ------------------------------ When the body of a young mother is found washed up on the banks of the Mataura River, a small rural community is rocked by her tragic suicide. But all is not what it seems. Sam Shephard, sole-charge police constable in Mataura, soon discovers the death was no suicide and has to face the realisation that there is a killer in town. To complicate the situation, the murdered woman was the wife of her former lover. When Sam finds herself on the list of suspects and suspended from duty, she must cast aside her personal feelings and take matters into her own hands. To find the murderer ... and clear her name. A taut, atmospheric and page-turning thriller, Overkill marks the start of an unputdownable and unforgettable series from one of New Zealand's finest crime writers. ------------------------------ ' A sassy heroine, fabulous sense of place, and rip-roaring stories with a twist' Kate Mosse ' Symon has created a compelling series lead, and her treatment of small-town New Zealand is superbly atmospheric. This one's a cracker' Liam Mc Ilvanney ' Overkill certainly feels like the beginning of something great. It's a clever first novel and a dark thriller that's well-paced and well-plotted ... with a satisfying and fitting ending' Culture Fly ' Symon nicely balances action, character and story in a well-drawn rural setting, and realistically speckles the book with light-hearted moments and humour throughout' Kiwi Crime ' Powerful, coolly assured, and an absolute belter of a read' Love Reading ' The key to the novel for me is definitely the humorous portrayal of the one-woman police band, both extremely naive and too eager to prove herself in the eyes of her superiors and against the silent backdrop of her parents' disappointment' Crime Review ' With a twisty plot, a protagonist who shines and beautifully written observations of the cruellest things, Overkill is crime fiction at its best and this is an outstanding book. I predict that this series is going to soar here in the UK and it deserves to' Crime Watch ' The author's style of storytelling is smooth and engaging, making Overkill very easy to read, which is enough to keep you cranking through the pages. The ending is a cracker ... We'll look forward to the next in the series because with the author's storytelling skills, the first is a pleasure to read' Crime Fiction Lover ' Overkill is Symon's first novel, but it reads like the polished effort of a genre veteran. More, please' Booklist
Delivery cost: 0.00
ISBN: 9781912374274
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781912374274
 
£8.99
 
Shop best deal
Magnify The Quality Of Silence
The Quality Of Silence

The Quality Of Silence


Category: Books
Description: Times Sunday Times Top- Ten Bestseller and Richard and Judy Book Club Choice.' An elegant and icily unique thriller: you won't read anything like it this year' Observer' Scary, suspenseful and so exquisitely, evocatively written. Everything you want in a wonderful novel' Liane Moriarty I'll risk my life for you. On 24 November Yasmin and her ten-year-old daughter Ruby set off on a journey across Northern Alaska. They're searching for Ruby's father, missing in the arctic wilderness. More isolated with each frozen mile they cover, they travel deeper into an endless night. And Ruby, deaf since birth, must brave the darkness where sight cannot guide her. She won't abandon her father. But winter has tightened its grip, and there is somebody out there who wants to stop them. Somebody tracking them through the dark. Praise for The Quality of Silence:' There are many things to love about Lupton's third novel, not least its stunning evocation of the stark, beautiful Alaskan wilds. An elegant and icily unique thriller: you won't read anything like it this year' Observer' Scary, suspenseful and so exquisitely, evocatively written. I found myself shivering as if I were there in Alaska with Ruby and her mother. Everything you want in a wonderful novel' Liane Moriarty, author of The Husband's Secret' Ambitious and imaginative. Narrated in part by Ruby (her deafness is treated with great sensitivity), the landscape, wildlife and bitter climate of Alaska are powerfully drawn. Chilling in every sense, you won't want to step away from this story' Sunday Mirror' A sophisticated thriller which brilliantly evokes the sublime and terrifying landscape of Alaska, the culture of the Inupiat people and the fragility of our planet' Sunday Telegraph' Like a breath of icy air, this relentlessly tense thriller is also a child's-eye family drama like none other. Not since Miss Smilla's Feeling for Snow have I shivered like this' Emma Donoghue, author of Room' Will have you gripped form start to finish' Cosmopolitan' A taut psychological thriller, The Quality of Silence will have your heart thumping. Masterful pacing, riveting plotting. Absolutely gripping' Louise Penny' A literary slow burn, whose focus is as much on human endurance and a mother's relationship with her deaf daughter as the mystery of her husband's disappearance. This is Lupton at the height of her storytelling powers' Daily Mail' An eerie eco-tale of disasters both real and man-made on the frozen tundra of Alaska. Yasmin and her daughter embark on what becomes an epic journey into the wilderness, [and] the alternating voices of mother and daughter are so compelling, it's hard not to want to go along for the ride. The temperature drops, the action heats up and the suspense builds with the storm. Even a white-out can't hide the darkness within' Vanessa Friedman, NY Times' A beautifully written thriller, and the way in which Lupton used the tundra as a metaphor for grief and faith in stunning. The voice of Ruby and her compassionate exploration of a life without sound only adds to the richness of the book' Press and Journal' A wonderful writer . . . absolutely gripping' Jane Garvey, BBC Radio 2 Women's Hour' The pressure is on to keep creating equally brilliant stores [and] Lupton has done that with The Quality of Silence' Red Magazine' An elegant, chilling read from a writer who continues to stretch the bounds of suspense' William Landay, author of Defending Jacob
Delivery cost: 0.00
ISBN: 9780349408156
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9780349408156
 
£8.99
 
Shop best deal
Magnify House Of Spines
House Of Spines

House Of Spines


Category: Books
Description: When a young man inherits a vast mansion from an estranged great-uncle, his apparent good fortune sours when unsettling things begin to happen ... A terrifying psychological thriller cum gothic ghost story from the bestselling author of A Suitable Lie. ' A beautifully written tale, original, engrossing and scary. It's a wonderful mixture, a psychological thriller with a touch of a ghost story (sort of), a dollop of the supernatural (but not really) and murder (perhaps), told through the vision of a druggie poet who hasn't taken his medicine and is therefore an unreliable witness (or is he?) ... a dark joy' The Times ' A deeply satisfying read' Sunday Times ' A fine, page-turning thriller' Daily Mail _________________ What you see isn't always real... Ran Mc Ghie's world has been turned upside down. A young, lonely and frustrated writer, and suffering from mental-health problems, he discovers that his long-dead mother was related to one of Glasgow's oldest merchant families. Not only that, Ran has inherited Newton Hall, a vast mansion that belonged to his great-uncle, who had been watching from afar as his estranged great-nephew grew up. Entering his new-found home, it seems Great-uncle Alexander has turned it into a temple to the written word - the perfect place for poet Ran. But everything is not as it seems. As he explores the Hall's endless corridors, Ran's grasp on reality appears to be loosening. And then he comes across an ancient lift; and in that lift a mirror. And in the mirror ... the reflection of a woman. A terrifying psychological thriller with more than a hint of the gothic, House of Spines is a love letter to the power of books, and a reminder that lust and betrayal can be deadly... _________________ Praise for Michael J. Malone: ' House of Spines is a gothic ghost story and psychological thriller all rolled into one. Brilliantly creepy, with a dash of Glasgow humour, I couldn't turn the pages fast enough. A spine-tingling treat' Lisa Gray, Daily Record ' From the stunning opening chapter, I was hooked. House of Spines is an intriguing tale with a haunting, gothic quality that compels you to keep reading till the end' Howard Linskey ' At first it seems like a poet's paradise, but something sinister lurks within the corridors ... a MUST READ' Daily Express ' The story twists and feints, pulling us along with it at every turn, the edginess of its central character making every development even more unsettling ... a chilling read, best savoured late on a dark night' Herald Scotland ' You might not want to be alone when you read this spine-chilling gothic thriller ... As he explores its endless corridors his grip on reality seems to be evaporating in this terrifying exploration of lust and betrayal' Sunday Post ' Prepare to have your marrow well and truly chilled by this deeply creepy Scottish horror ... A complex and multi-layered story - perfect for a wintry night' Sunday Mirror ' Beautifully crafted and colourfully descriptive ... keeps the reader gripped by an uneasy presence, a chill, literally, down the spine' Undiscovered Scotland ' Malone is a massive talent ... get on board now so you can brag you were reading his books long before the rest of the world' Luca Veste ' Vivid, visceral and compulsive' Ian Rankin ' A terrific read ... I read it in one sitting' Martina Cole ' A deeply personal thriller that will keep the reader turning those pages, with twists and turns designed to keep the heart pumping' Russel D. Mc Lean
Delivery cost: 0.00
ISBN: 9781910633861
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781910633861
 
£8.99
 
Shop best deal
Magnify Blood Song
Blood Song

Blood Song


Category: Books
Description: The action swings from London to Sweden, and then back into the past, to Franco's Spain, as Roy & Castells hunt a monstrous killer ... in the latest instalment of Johana Gustawsson's award-winning, international bestselling series. *** Longlisted for the CWA International Dagger*** ' Historical sections highlight, in distressing detail, the atrocious treatment of mothers-to-be in Franco's Spain ... A satisfying, full-fat mystery' The Times ' Assured telling of a complex story' Sunday Times ' Gustawsson's writing is so vivid, it's electrifying. Utterly compelling' Peter James _________________ Spain, 1938: The country is wracked by civil war, and as Valencia falls to Franco's brutal dictatorship, Republican Therese witnesses the murders of her family. Captured and sent to the notorious Las Ventas women's prison, Therese gives birth to a daughter who is forcibly taken from her. Falkenberg, Sweden, 2016: A wealthy family is found savagely murdered in their luxurious home. Discovering that her parents have been slaughtered, Alienor Lindbergh, a new recruit to the UK's Scotland Yard, rushes back to Sweden and finds her hometown rocked by the massacre. Profiler Emily Roy joins forces with Alienor and soon finds herself on the trail of a monstrous and prolific killer. Little does she realise that this killer is about to change the life of her colleague, true-crime writer Alexis Castells. Joining forces once again, Roy and Castells' investigation takes them from the Swedish fertility clinics of the present day back to the terror of Franco's rule, and the horrifying events that took place in Spanish orphanages under its rule. Terrifying, vivid and recounted at breakneck speed, Blood Song is not only a riveting thriller and an examination of corruption in the fertility industry, but a shocking reminder of the atrocities of Spain's dictatorship, in the latest, stunning instalment in the award-winning Roy & Castells series. _________________ ' French novelist Johana Gustawsson writes novels of startling originality. Blood Song [is] truly horrifying' Sunday Times ' Her sleuths tracking a monstrous killer, transporting us from modern-day fertility clinics in Sweden to the abuses of Spanish orphanages under the brutal rule of General Franco ... a truly European thriller' Financial Times ' Gritty, bone-chilling, and harrowing - it's not for the faint of heart, and not to be missed' Crime by the Book ' A relentless heart-stopping masterpiece, filled with nightmarish situations that will keep you awake long into the dark nights of winter' New York Journal of Books ' Emotional and atmospheric' New Books Magazine ' Intricately plotted, visceral and emotional the author ramps up the tension and the unfolding keeps the reader guessing to the very end. Scenes are raw, vivid and gripping' Promoting Crime ' I don't think there's a crime writer who writes with such intelligence, darkness and deep sadness as Johana Gustawsson. This was extraordinary' Louise Beech ' Blood Song caught and has held onto my thoughts, it is clever, provocative, and a seriously good read' Love Reading ' A fascinating and engrossing read, but also one that I found intensely harrowing, deeply intimate and which made me cry' Live & Deadly ' A real page-turner, I loved it' Martina Cole ' Cleverly plotted, simply excellent' Ragnar Jonasson ' A must-read' Daily Express ' Bold and audacious' R. J. Ellory
Delivery cost: 0.00
ISBN: 9781912374816
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781912374816
 
£8.99
 
Shop best deal
Magnify The Bone Code
The Bone Code

The Bone Code


Category: Books
Description: NUMBER ONE NEW YORK TIMES bestselling author KATHY REICHS returns with her next edge-of-your seat thriller featuring forensic anthropologist Temperance Brennan. A storm has hit South Carolina, dredging up crimes of the past. En route to Isle of Palms, a barrier island off the South Carolina coast, forensic anthropologist Temperance Brennan receives a call from the Charleston coroner. During the storm, a medical waste container has washed up on the beach. Inside are two decomposed bodies wrapped in plastic sheeting and bound with electrical wire. Chillingly, Tempe recognizes many details as identical to those of an unsolved case she handled in Quebec fifteen earlier. With a growing sense of foreboding, she flies to Montreal to gather evidence and convince her boss Pierre La Manch to reopen the cold case. She also seeks the advice-and comfort-of her longtime beau Andrew Ryan. Meanwhile, a storm of a different type gathers force in South Carolina. The citizens of Charleston are struck by capnocytophaga, a bacterium that, at its worst, can eat human flesh. Thousands panic and test themselves for a rare genetic mutation that may have rendered them vulnerable. Shockingly, Tempe eventually deduces not only that the victims in both grisly murder cases are related, but that the murders and the disease outbreak also have a common cause . . . PRAISE FOR KATHY REICHS ' A Conspiracy of Bones shows off Kathy Reichs' dazzling new level of plotting mastery. A thrilling read from one of my favorite writers' KARIN SLAUGHTER, #1 internationally bestselling author of The Last Widow and The Good Daughter ' One of the absolute best thrillers of the year! Both Temperance Brennan and Kathy Reichs are at the top of their games in this brilliant rollercoaster of a tale. I can't recall when this many twists have been so masterfully woven into a novel. But, of course, it's not all about plot. The characters, too-good, bad and in between-come breathtakingly alive with heart-gripping effect. A great series has just gotten greater' JEFFERY DEAVER, #1 internationally bestseller author of The Bone Collector and The Never Game ' Don't miss this one! The corpse is ghastly. The investigation is intense. So many pulse-pounding twists and surprises-it kept me guessing till the end!' R. L. STINE, bestselling author Goosebumps and Fear Street ' Tempe Brennan is back, dealing with health issues, career setbacks, and the nagging-and driving-fear of inadequacy that is the flipside of her talent. Reich's fast-paced, tightly-constructed, and very contemporary story dives underground here, both literally and virtually, as she follows the thinnest of threads deeper and deeper into a shocking conspiracy. You will find it hard to put down' MARK BOWDEN, #1 New York Times bestselling author of The Last Stone and Black Hawk Down ' No face, no hands, and a ton of breathtaking questions. I dare you to figure out all the red herrings. So utterly good! This is Kathy Reichs doing what she does best: sorting through the bones until the shocking end' BRAD MELTZER, #1 New York Times bestselling author of The Escape Artist ' Kathy Reichs writes smart-no, make that brilliant-mysteries that are as realistic as non-fiction and as fast-paced as the best thrillers about Jack Reacher or Alex Cross' JAMES PATTERSON ' Nobody does forensics thrillers like Kathy Reichs. She's the real deal' DAVID BALDACCI ' Kathy Reichs continues to be one of the most distinctive and talented writers in the genre. Her legions of readers worldwide will agree with me when I declare that the more books she writes, the more enthusiastic fans she'll garner' SANDRA BROWN ' Each book in Kathy Reichs's fantastic Temperance Brennan series is better than the last. They're filled with riveting twists andturns. No matter how many novels she writes, I just can't get enough!' LISA SCOTTOLINE ' Every minute in the morgue with Tempe is golden' THE NEW YORK TIMES BOOK REVIEW ' Brennan is a winner, and so is Reichs' DAILY NEWS
Delivery cost: 0.00
ISBN: 9781471188893
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781471188893
 
£20.00
 
Shop best deal
Magnify Sound Of Hunger
Sound Of Hunger

Sound Of Hunger


Category: Books
Description: Sound of Hunger is a true story that centres on two German brothers, Erich and Georg Gerth, u-boat commanders, and the First Word War and its aftermath. The Gerths' lives and careers as navy officers are set against the military, political and social environment of their times. Carefully-nurtured myths of national innocence and guilt are uncovered; discrediting truths and war crimes of both the Allies and Germany are brought into the limelight. This is not conventional history, but a personal view of the events that were integral to the Gerth brothers, to see how they were changed by what they heard, were taught and experienced. Sound of Hunger is unashamedly intimate in selection, perhaps eccentric in places; a personal journey that explains what was newly-found, how it was investigated and understood. Whatever you think you know about this war, be prepared to challenge your beliefs. The book takes its title from the thrust of the war, not in the trenches, but in the deliberate attempts by both sides to starve each other's civilian populations. The damage to Germany's children was generational as food shortages were deliberately extended by the Allies to force Germany to a debilitating peace. The brothers were born in booming Berlin in the 1880s, their father dying when they were young. Their mother sacrificed to see them through one of Berlin's most prestigious secondary schools and paid their considerable fees as cadets. In the burgeoning naval fleet, they were of the lowest social class allowed into this elite new force. Their careers were exciting, extracted from German archives: spying in South America, bombardment of the English coast, sea battles, torpedoed and mined ships, and desperate survivals. One, as a French prisoner of war for over two years, made daring escape attempts, the other scuttling his boat in the Mediterranean amid collapsing Austrian armies. Remarkable contacts tumble from the pages, villains and heroes, the Kaiser, Alfred von Tirpitz, family-friend Wilhelm Canaris, Karl Doenitz, the Red Baron, Adolf Hitler. The Gerths' personal decisions are interwoven with Germany's bid for world power, naval training, the founding of the Flanders u-boat bases, the importance of the Baltic and the Mediterranean, the economic blockade of Germany and its devastating effects on European neutral countries, unfettered submarine warfare, prison camps, Britain's virulent propaganda designed to drag America into the conflict, and the German collapse. The story does not end well. The brothers return to Germany and the post-war fight to the death between a new socialist republic, a murderous officer corps and the Spartacist revolution. The Gerths are forced to take sides. One becomes a philosopher and a businessman, seeking mental refuge. The other marries a countess and is swept into extreme right-wing politics: manning the barricades, the murder of communist leaders Karl Liebknecht and Rosa Luxemburg, covertly preparing the second u-boat fleet for the next war. Canaris is everywhere scheming. Close family contacts are developed with Europe's Catholic hierarchy, even to Eugenio Pacelli, the pope-to-be, the Spanish royal family, and with elite Paris society, in a very public attempt to rouse religious sentiment against a second world war. Everything falls apart. The German President and Foreign Minister together act with Rudolf Hess to ruin one of the brothers. Heinrich Himmler moves to take over of the legendary Ufa film studios, beggaring another family member. The family's Jewish connections are disclosed: it is a time of forged passports, concentration camps, attempted flight to South America; and children hidden in Roman convents. The Gestapo steps in. One brother dies in poignant and lurid circumstances, the other becomes a recluse after watching the ruins of his family home and business, flattened by British carpet bombing of a demilitarised town.
Delivery cost: 0.00
ISBN: 9781911604419
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781911604419
 
£30.00
 
Shop best deal
Magnify From Aconite To The Zodiac Killer
From Aconite To The Zodiac Killer

From Aconite To The Zodiac Killer


Category: Books
Description: ' The Dictionary of Crime is now the first book I reach for when beginning a new novel. An essential resource, it's packed with explanations, insider information, contemporary and historical slang, as well as some downright bizarre laws and practices. It's funny, fascinating and a damn good read' M. W CRAVEN, winner of the 2019 Crime Writers Association Gold Dagger for best crime novel of the year for The Puppet Show' A really good idea . . . executed neatly to come up with the perfect gift for crime lovers' MAT COWARD, Morning Star' I found myself rolling around in it for hours, like a gangster's moll on a bed full of money. Sheer delight!' CATRIONA Mc PHERSON' Where was this book when I started writing? From Aconite to the Zodiac Killer is the essential companion for any serious reader or writer of crime' LEYE ADENLE, author of When Trouble Sleeps' A fascinating compendium of crime facts which should be on the shelves of every crime writer - and every crime reader' SIMON BRETT' This is a dangerous book in so many ways, chock full of ways of killing people, from undetectable poisons to various types of guns. It contains riveting accounts of notorious murderers, is crammed with fascinating details of slang, and precise particulars of police procedures. The perfect gift for any true crime enthusiast and an indispensable guide for all crime fiction writers.' S. W. WILLIAMS, author of Small Deaths and How to Write Crime Fiction' A remarkable achievement. At once elucidating and compelling, indispensable and unputdownable. It reads like a page-turning thriller. Whether a crime writer who needs to distinguish a blood agent from a bum beef or a reader with an interest in queer coal makers, this lexicon will keep you hooked, and leave you sublimely informed.' GARY DONNELLY, author of Killing in Your Name and Blood Will Be Born' Fascinating, insightful and taking up permanent residency on my desk. Amanda Lees' Dictionary of Crime is my new bible!' CHRIS WHITTAKER, award-winning author of Tall Oaks, All The Wicked Girls and We Begin at the End' What a little gem this is - such a great idea and a valuable resource for writers. I found myself dipping into it at intervals and marvelling at the extent of the research that's gone into it, as well as chuckling over some of the more unusual entries. My personal favourites? BINGO seat, nicker, moll buzzer and lully-prigger. Wouldn't have had a clue what they meant . . . but I'm determined to work them in somewhere in a future novel!' G. J. MINETTT, author of The Syndicate ' A fascinating journey through the dark side of the human psyche. Highly recommended for anyone interested in criminals and crime' PATRICK REDMOND, bestselling author of The Wishing Game An essential popular A- Z reference guide for fans of crime fiction and true crime, in books, TV and film, helping to make sense of everything from asphyxiation to VX nerve agent. This is an indispensable guide for fans of true crime and crime fiction, whether in books, film or on TV, who want to look behind the crime, to understand the mechanics of an investigation, to walk in their favourite detectives' shoes and, most importantly, to solve the clues. To do that, one needs to be fluent in the language of the world of crime. We need to know what that world-weary DI is talking about when she refers to another MISPER. We have to immediately grasp the significance of the presence of paraquat, and precisely why it is still a poison of choice. If you want to know how many murders it takes for a killer to be defined as a serial killer, what Philip Marlowe means when he talks about being 'on a confidential lay' and why the 'fruit of a poisonous tree' is a legal term rather than something you should avoid on a country walk, this is the reference book you've been waiting for. It covers police and procedural terms and jargon of many different countries; acronyms; murder methods; criminal definitions, including different types of killers; infamous killers and famous detectives; notorious cases often referred to in crime fiction and true crime; gangster slang, including that of the Eastern European mafia; definitions of illegal drugs; weapons; forensic terminology; types of poisons; words and phrases used in major crime genres, including detective fiction, legal thrillers, courtroom dramas, hardboiled crime, Scandi and Tartan Noir, cosy crime and psychological thrillers; criminology terms; and the language of the courts and the legal systems of British, American, French, Nordic and other countries. From Aconite to the Zodiac Killer is an essential, go-to resource for readers and even for writers of crime fiction. More than simply a glossary, this is a guide that provides a doorway into a supergenre, and one that is not just for readers, but also for the many fans of film and TV dramas, of podcasts, and crime blogs. It is also an indispensable resource for writers or would-be writers of crime fiction.
Delivery cost: 0.00
ISBN: 9781472143297
Review this product
 
Waterstones
Review this store
Waterstones
Product ID: 9781472143297
 
£10.99
 
Shop best deal
Magnify Fast Forward: Instructional Texts And Teachers Guide Cd-roms Easy-buy Pack (164 Books + 20 Cd-roms)
Fast Forward: Instructional Texts And Teachers Guide Cd-roms Easy-buy Pack (164 Books + 20 Cd-roms)

Fast Forward: Instructional Texts And Teachers Guide Cd-roms Easy-buy Pack (164 Books + 20 Cd-roms)


Category: Books
Description: This pack contains one copy each of the following titles: Fast Forward Blue: Animal Hospital ( Non-fiction) Level 10 Fast Forward Blue: Antartic Animals ( Non-fiction) Level 9 Fast Forward Blue: A Plastic World ( Non-fiction) Level 11 Fast Forward Blue: Buzz and Zip Get Lost ( Fiction) Level 10 Fast Forward Blue: Cars ( Non-fiction) Level 9 Fast Forward Blue: Dad and Dan Go Camping ( Fiction) Level 10 Fast Forward Blue: Discovering Planets ( Non-fiction) Level 9 Fast Forward Blue: Human Movement ( Non-fiction) Level 11 Fast Forward Blue: Insect Sounds ( Non-fiction) Level 11 Fast Forward Blue: Join Up Now ( Non-fiction) Level 10 Fast Forward Blue: Jump! ( Fiction) Level 11 Fast Forward Blue: Magic Tricks ( Fiction) Level 9 Fast Forward Blue: On the Team ( Fiction) Level 9 Fast Forward Blue: Saying Goodbye ( Fiction) Level 11 Fast Forward Blue: Shark! ( Fiction) Level 10 Fast Forward Blue: Skeletons ( Non-fiction) Level 9 Fast Forward Blue: Sports Clothes ( Non-fiction) Level 11 Fast Forward Blue: Teacher's Guide CD- ROM Level 10 Fast Forward Blue: Teacher's Guide CD- ROM Level 11 Fast Forward Blue: Teacher's Guide CD- ROM Level 9 Fast Forward Blue: The Chalk Circle ( Fiction) Level 11 Fast Forward Blue: Time Travel: The Dinosaurs ( Fiction) Level 9 Fast Forward Blue: Travelling Around ( Non-fiction) Level 10 Fast Forward Blue: Voting ( Non-fiction) Level 10 Fast Forward Emerald: Democracy in Action ( Non-fiction) Level 25 Fast Forward Emerald: Dogs at Work ( Non-fiction) Level 25 Fast Forward Emerald: Eyes at Work ( Non-fiction) Level 25 Fast Forward Emerald: Fire Ready ( Fiction) Level 25 Fast Forward Emerald: It's All About Physics ( Non-fiction) Level 25 Fast Forward Emerald: Moon Bubble ( Fiction) Level 25 Fast Forward Emerald: More Like Home ( Fiction) Level 25 Fast Forward Emerald: Not Again ( Fiction) Level 25 Fast Forward Emerald: Teacher's Guide CD- ROM Level 25 Fast Forward Emerald: The Great Wall of China ( Non-fiction) Level 25 Fast Forward Gold: Bears in Camp ( Fiction) Level 21 Fast Forward Gold: Earthquakes ( Non-fiction) Level 22 Fast Forward Gold: Electricity ( Non-fiction) Level 22 Fast Forward Gold: Galileo Galilei and the Beginning of Modern Science ( Non-fiction) Level 21 Fast Forward Gold: I Wish ( Fiction) Level 22 Fast Forward Gold: Life in the Amazon Jungle ( Non-fiction) Level 21 Fast Forward Gold: Locust Plague ( Non-fiction) Level 21 Fast Forward Gold: Mining ( Non- Fiction) Level 22 Fast Forward Gold: Mudslide ( Fiction) Level 22 Fast Forward Gold: My Best Friend's a Genius ( Fiction) Level 21 Fast Forward Gold: New Neighbours ( Fiction) Level 21 Fast Forward Gold: Nico's List ( Fiction) Level 22 Fast Forward Gold: Papua New Guinea ( Non-fiction) Level 21 Fast Forward Gold: Ralegan Siddhi: A Special Community ( Non-fiction) Level 22 Fast Forward Gold: Space Junk, Meteorites and Comets ( Non-fiction) Level 21 Fast Forward Gold: Teacher's Guide CD- ROM Level 21 Fast Forward Gold: Teacher's Guide CD- ROM Level 22 Fast Forward Gold: The Key Cutter's Grandson ( Fiction) Level 22 Fast Forward Gold: The Riddle of the Camel Race ( Fiction) Level 21 Fast Forward Gold: The Story of Alexander Fleming ( Non-fiction) Level 22 Fast Forward Green: Aspirin ( Non-fiction) Level 13 Fast Forward Green: Banks and Banking ( Non-fiction) Level 14 Fast Forward Green: Buzz Takes Over ( Fiction) Level 14 Fast Forward Green: Death of the Dinosaur ( Non-fiction) Level 13 Fast Forward Green: Don't Embarrass Me, Dad! ( Fiction) Level 13 Fast Forward Green: Fixing Cars ( Fiction) Level 14 Fast Forward Green: Gold ( Non-fiction) Level 12 Fast Forward Green: Gold Rush ( Non-fiction) Level 14 Fast Forward Green: Hip- Hop ( Non-fiction) Level 13 Fast Forward Green: Metal Mouth ( Fiction) Level 13 Fast Forward Green: Peacekeepers ( Non-fiction) Level 13 Fast Forward Green: Powering Cars ( Non-fiction) Level 14 Fast Forward Green: Reduce, Reuse, Recycle ( Non-fiction) Level 14 Fast Forward Green: Secret Agent ( Fiction) Level 14 Fast Forward Green: Super Fit ( Fiction) Level 12 Fast Forward Green: Teacher's Guide CD- ROM Level 12 Fast Forward Green: Teacher's Guide CD- ROM Level 13 Fast Forward Green: Teacher's Guide CD- ROM Level 14 Fast Forward Green: The Call of the Wolf ( Fiction) Level 12 Fast Forward Green: The Game ( Fiction) Level 12 Fast Forward Green: The Heart ( Non-fiction) Level 14 Fast Forward Green: The Inventors Club ( Fiction) Level 14 Fast Forward Green: The Water Cycle ( Non-fiction) Level 13 Fast Forward Green: Thomas Edison ( Non-fiction) Level 12 Fast Forward Green: Time Travel: Ship Ahoy! ( Fiction) Level 13 Fast Forward Green: Water World ( Non-fiction) Level 12 Fast Forward Orange: Acting the Part ( Non-fiction) Level 16 Fast Forward Orange: A Very Long Journey ( Non-fiction) Level 15 Fast Forward Orange: Dad's Trick ( Fiction) Level 15 Fast Forward Orange: Everything is Changing ( Fiction) Level 15 Fast Forward Orange: Heating Up ( Non-fiction) Level 15 Fast Forward Orange: Marty and the Magazine ( Fiction) Level 15 Fast Forward Orange: Mercury and the Woodcutter ( Fiction) Level 16 Fast Forward Orange: Natural Partners ( Non-fiction) Level 15 Fast Forward Orange: New Tricks ( Fiction) Level 16 Fast Forward Orange: Scary Movie ( Fiction) Level 16 Fast Forward Orange: Simple Machines ( Non-fiction) Level 16 Fast Forward Orange: Teacher's Guide CD- ROM Level 15 Fast Forward Orange: Teacher's Guide CD- ROM Level 16 Fast Forward Orange: The Changing Map ( Non-fiction) Level 16 Fast Forward Orange: The Golden Touch ( Fiction) Level 15 Fast Forward Orange: UFO: Ordinary or Aliens? ( Non-fiction) Level 15 Fast Forward Orange: Unusual Hobbies ( Non-fiction) Level 16 Fast Forward Orange: Wait and See ( Fiction) Level 16 Fast Forward Orange: Walking on the Moon ( Non-fiction) Level 15 Fast Forward Orange: Wheels ( Non- Fiction) Level 16 Fast Forward Purple: Building the Pyramids ( Non-fiction) Level 20 Fast Forward Purple: Buzz Sees the Difference ( Fiction) Level 19 Fast Forward Purple: Dirt on My Shoe ( Fiction) Level 20 Fast Forward Purple: Experimenting With Magnets ( Non-fiction) Level 19 Fast Forward Purple: Gadget Boy and Kid Fantastic ( Fiction) Level 20 Fast Forward Purple: Garbage ( Non-fiction) Level 19 Fast Forward Purple: Getting the Picture ( Non-fiction) Level 20 Fast Forward Purple: Making Headlines ( Fiction) Level 20 Fast Forward Purple: People Underground ( Non-fiction) Level 19 Fast Forward Purple: Pompeii ( Non-fiction) Level 19 Fast Forward Purple: Teacher's Guide CD- ROM Level 19 Fast Forward Purple: Teacher's Guide CD- ROM Level 20 Fast Forward Purple: The Beginnings of Democracy ( Non-fiction) Level 20 Fast Forward Purple: The Coat ( Fiction) Level 20 Fast Forward Purple: The Giant's Causeway ( Fiction) Level 19 Fast Forward Purple: The Great Depression ( Non-fiction) Level 20 Fast Forward Purple: The Green Belt Movement ( Non-fiction) Level 19 Fast Forward Purple: Trapped ( Fiction) Level 19 Fast Forward Purple: Venus Bay ( Fiction) Level 19 Fast Forward Purple: Wind Power ( Non-fiction) Level 20 Fast Forward Silver: Aztec Beliefs ( Non-fiction) Level 23 Fast Forward Silver: Bruno's Tea ( Fiction) Level 23 Fast Forward Silver: Danny's Dream ( Fiction) Level 24 Fast Forward Silver: Discovering Chemistry ( Non-fiction) Level 24 Fast Forward Silver: Discovering Metals ( Non-fiction) Level 23 Fast Forward Silver: Forces in Action ( Non-fiction) Level 23 Fast Forward Silver: Goal! ( Fiction) Level 23 Fast Forward Silver: It's a Jungle Out There ( Fiction) Level 23 Fast Forward Silver: Living in Space ( Non-fiction) Level 24 Fast Forward Silver: Lizzie's Hidden Message ( Fiction) Level 23 Fast Forward Silver: My Best Friend Thinks I'm a Genius ( Fiction) Level 24 Fast Forward Silver: People Have Their Say ( Non-fiction) Level 23 Fast Forward Silver: Shipwreck ( Fiction) Level 24 Fast Forward Silver: Teacher's Guide CD- ROM Level 23 Fast Forward Silver: Teacher's Guide CD- ROM Level 24 Fast Forward Silver: The Contest ( Fiction) Level 23 Fast Forward Silver: The European Union ( Non-fiction) Level 24 Fast Forward Silver: The House of Wisdom ( Non-fiction) Level 24 Fast Forward Silver: Twins ( Non-fiction) Level 23 Fast Forward Silver: Underground Rescue ( Non-fiction) Level 24 Fast Forward Turquoise: Animal Travellers ( Non-fiction) Level 18 Fast Forward Turquoise: Battle of the Bands ( Fiction) Level 17 Fast Forward Turquoise: Beginnings ( Non-fiction) Level 18 Fast Forward Turquoise: Diary of a Twister Chaser ( Non-fiction) Level 18 Fast Forward Turquoise: Drugs in Sport ( Non-fiction) Level 17 Fast Forward Turquoise: Fossil Fuels ( Non-fiction) Level 17 Fast Forward Turquoise: Gadget Boy Saves the Day ( Fiction) Level 17 Fast Forward Turquoise: Glacier ( Fiction) Level 18 Fast Forward Turquoise: Helping Out ( Non-fiction) Level 17 Fast Forward Turquoise: Inside the Gate ( Fiction) Level 17 Fast Forward Turquoise: Renovations ( Fiction) Level 17 Fast Forward Turquoise: Saving Coral Reefs ( Non-fiction) Level 17 Fast Forward Turquoise: Small Pox ( Non-fiction) Level 18 Fast Forward Turquoise: Teacher's Guide CD- ROM Level 17 Fast Forward Turquoise: Teacher's Guide CD- ROM Level 18 Fast Forward Turquoise: The African Grasslands ( Non-fiction) Level 17 Fast Forward Turquoise: The Bully ( Fiction) Level 18 Fast Forward Turquoise: The Graveyard Shift ( Fiction) Level 18 Fast Forward Turquoise: The Inventors' Club Meets Again ( Fiction) Level 18 Fast Forward Turquoise: World Heritage ( Non-fiction) Level 18 Fast Forward Yellow: A Night Out ( Fiction) Level 7 Fast Forward Yellow: Animal Disguises ( Non-fiction) Level 8 Fast Forward Yellow: Animal Groups ( Non-fiction) Level 6 Fast Forward Yellow: At the Shops ( Non-fiction) Level 6 Fast Forward Yellow: Ben Fox Saves the Day ( Fiction) Level 6 Fast Forward Yellow: Bridges ( Non-fiction) Level 7 Fast Forward Yellow: Dad and Dan Go Fishing ( Fiction) Level 6 Fast Forward Yellow: Food from the World ( Non-fiction) Level 6 Fast Forward Yellow: Harry Helps Out ( Fiction) Level 7 Fast Forward Yellow: Hot and Cold ( Non-fiction) Level 8 Fast Forward Yellow: Ice on Earth ( Non-fiction) Level 7 Fast Forward Yellow: Making a Cake ( Non-fiction) Level 8 Fast Forward Yellow: Move It! ( Non-fiction) Level 6 Fast Forward Yellow: Noises in the Night ( Fiction) Level 6 Fast Forward Yellow: Skateboarding ( Non-fiction) Level 7 Fast Forward Yellow: Taking Off ( Fiction) Level 8 Fast Forward Yellow: Teacher's Guide CD- ROM Level 6 Fast Forward Yellow: Teacher's Guide CD- ROM Level 7 Fast Forward Yellow: Teacher's Guide CD- ROM Level 8 Fast Forward Yellow: The Jewellery Store Robbery ( Fiction) Level 8 Fast Forward Yellow: The Mess ( Fiction) Level 7 Fast Forward Yellow: The Mystery of the Missing Bike ( Fiction) Level 8 Fast Forward Yellow: Understanding Rules ( Non-fiction) Level 8 Fast Forward Yellow: What's the Time? ( Non-fiction) Level 7 Engage your less confident readers and improve reading attainment with Fast Forward. This series offers a wide range of age-appropriate, high-interest readers for children in Key Stage 2 and 3 who are struggling to make progress with their reading. Each book has been carefully levelled to ensure steady progression with a range of text types introduced which children can use as a model for their own writing. #ffpacks #ff-easy-buy #pm19-offer
ISBN: 9789999513081
Review this product
 
Scholastic
Review this store
Scholastic
Product ID: 106082
 
£1724.78
 
Shop best deal
Magnify Fast Forward: Super Easy-buy Pack (224 Books + 20 Cd-roms)
Fast Forward: Super Easy-buy Pack (224 Books + 20 Cd-roms)

Fast Forward: Super Easy-buy Pack (224 Books + 20 Cd-roms)


Category: Books
Description: This pack contains one copy each of the following titles: Fast Forward Blue: Animal Hospital ( Non-fiction) Level 10 Fast Forward Blue: Antartic Animals ( Non-fiction) Level 9 Fast Forward Blue: A Plastic World ( Non-fiction) Level 11 Fast Forward Blue: A World Without Cars ( Non-fiction) Level 10 Fast Forward Blue: Buzz and Zip Get Lost ( Fiction) Level 10 Fast Forward Blue: Cars ( Non-fiction) Level 9 Fast Forward Blue: Cars of the Future ( Non-fiction) Level 9 Fast Forward Blue: Dad and Dan Go Camping ( Fiction) Level 10 Fast Forward Blue: Dad and Dan Go Skateboarding ( Fiction) Level 9 Fast Forward Blue: Discovering Planets ( Non-fiction) Level 9 Fast Forward Blue: Human Movement ( Non-fiction) Level 11 Fast Forward Blue: Insect Sounds ( Non-fiction) Level 11 Fast Forward Blue: Join Up Now ( Non-fiction) Level 10 Fast Forward Blue: Jump! ( Fiction) Level 11 Fast Forward Blue: Looking at Space ( Non-fiction) Level 9 Fast Forward Blue: Magic Tricks ( Fiction) Level 9 Fast Forward Blue: Molly and the Band ( Fiction) Level 10 Fast Forward Blue: On the Team ( Fiction) Level 9 Fast Forward Blue: Saying Goodbye ( Fiction) Level 11 Fast Forward Blue: Shark! ( Fiction) Level 10 Fast Forward Blue: Skeletons ( Non-fiction) Level 9 Fast Forward Blue: Slam Dunk ( Fiction) Level 11 Fast Forward Blue: Sports Clothes ( Non-fiction) Level 11 Fast Forward Blue: Teacher's Guide CD- ROM Level 10 Fast Forward Blue: Teacher's Guide CD- ROM Level 11 Fast Forward Blue: Teacher's Guide CD- ROM Level 9 Fast Forward Blue: The Chalk Circle ( Fiction) Level 11 Fast Forward Blue: The Human Body ( Non-fiction) Level 11 Fast Forward Blue: The World Wide Web ( Non-fiction) Level 11 Fast Forward Blue: Time Travel: The Dinosaurs ( Fiction) Level 9 Fast Forward Blue: Trains ( Non-fiction) Level 10 Fast Forward Blue: Travelling Around ( Non-fiction) Level 10 Fast Forward Blue: Voting ( Non-fiction) Level 10 Fast Forward Emerald: Democracy in Action ( Non-fiction) Level 25 Fast Forward Emerald: Dogs at Work ( Non-fiction) Level 25 Fast Forward Emerald: Eyes at Work ( Non-fiction) Level 25 Fast Forward Emerald: Fire Ready ( Fiction) Level 25 Fast Forward Emerald: It's All About Physics ( Non-fiction) Level 25 Fast Forward Emerald: Moon Bubble ( Fiction) Level 25 Fast Forward Emerald: More Like Home ( Fiction) Level 25 Fast Forward Emerald: Not Again ( Fiction) Level 25 Fast Forward Emerald: Nuclear Energy ( Non-fiction) Level 25 Fast Forward Emerald: Out of This World ( Fiction) Level 25 Fast Forward Emerald: Teacher's Guide CD- ROM Level 25 Fast Forward Emerald: The Channel Tunnel ( Non-fiction) Level 25 Fast Forward Emerald: The Great Wall of China ( Non-fiction) Level 25 Fast Forward Gold: Bears in Camp ( Fiction) Level 21 Fast Forward Gold: Drilling for Oil ( Non-fiction) Level 22 Fast Forward Gold: Earthquakes ( Non-fiction) Level 22 Fast Forward Gold: Electricity ( Non-fiction) Level 22 Fast Forward Gold: Galileo Galilei and the Beginning of Modern Science ( Non-fiction) Level 21 Fast Forward Gold: Germs ( Non-fiction) Level 22 Fast Forward Gold: GM Foods ( Non-fiction) Level 21 Fast Forward Gold: I Wish ( Fiction) Level 22 Fast Forward Gold: Life in the Amazon Jungle ( Non-fiction) Level 21 Fast Forward Gold: Locust Plague ( Non-fiction) Level 21 Fast Forward Gold: Mining ( Non- Fiction) Level 22 Fast Forward Gold: Mudslide ( Fiction) Level 22 Fast Forward Gold: My Best Friend's a Genius ( Fiction) Level 21 Fast Forward Gold: New Neighbours ( Fiction) Level 21 Fast Forward Gold: Nico's List ( Fiction) Level 22 Fast Forward Gold: Papua New Guinea ( Non-fiction) Level 21 Fast Forward Gold: Rainforests ( Non-fiction) Level 21 Fast Forward Gold: Ralegan Siddhi: A Special Community ( Non-fiction) Level 22 Fast Forward Gold: Run for Your Life ( Fiction) Level 22 Fast Forward Gold: Space Junk, Meteorites and Comets ( Non-fiction) Level 21 Fast Forward Gold: Teacher's Guide CD- ROM Level 21 Fast Forward Gold: Teacher's Guide CD- ROM Level 22 Fast Forward Gold: The Key Cutter's Grandson ( Fiction) Level 22 Fast Forward Gold: The Riddle of the Camel Race ( Fiction) Level 21 Fast Forward Gold: The Story of Alexander Fleming ( Non-fiction) Level 22 Fast Forward Gold: The Story of Icarus ( Fiction) Level 21 Fast Forward Green: Alternative Energy ( Non-fiction) Level 14 Fast Forward Green: Aspirin ( Non-fiction) Level 13 Fast Forward Green: Banks and Banking ( Non-fiction) Level 14 Fast Forward Green: Buzz Takes Over ( Fiction) Level 14 Fast Forward Green: Death of the Dinosaur ( Non-fiction) Level 13 Fast Forward Green: Dinosaur Scientists ( Non-fiction) Level 13 Fast Forward Green: Don't Embarrass Me, Dad! ( Fiction) Level 13 Fast Forward Green: Fixing Cars ( Fiction) Level 14 Fast Forward Green: Gold ( Non-fiction) Level 12 Fast Forward Green: Gold Rush ( Non-fiction) Level 14 Fast Forward Green: Hip- Hop ( Non-fiction) Level 13 Fast Forward Green: Metal Mouth ( Fiction) Level 13 Fast Forward Green: Parks ( Non-fiction) Level 12 Fast Forward Green: Peacekeepers ( Non-fiction) Level 13 Fast Forward Green: Plants ( Non-fiction) Level 14 Fast Forward Green: Powering Cars ( Non-fiction) Level 14 Fast Forward Green: Reduce, Reuse, Recycle ( Non-fiction) Level 14 Fast Forward Green: Save Water ( Non-fiction) Level 12 Fast Forward Green: Secret Agent ( Fiction) Level 14 Fast Forward Green: Street Art ( Non-fiction) Level 13 Fast Forward Green: Super Fit ( Fiction) Level 12 Fast Forward Green: Teacher's Guide CD- ROM Level 12 Fast Forward Green: Teacher's Guide CD- ROM Level 13 Fast Forward Green: Teacher's Guide CD- ROM Level 14 Fast Forward Green: The Call of the Wolf ( Fiction) Level 12 Fast Forward Green: The Game ( Fiction) Level 12 Fast Forward Green: The Heart ( Non-fiction) Level 14 Fast Forward Green: The Inventors Club ( Fiction) Level 14 Fast Forward Green: The Mammoth Trap ( Fiction) Level 12 Fast Forward Green: The Water Cycle ( Non-fiction) Level 13 Fast Forward Green: Thomas Edison ( Non-fiction) Level 12 Fast Forward Green: Thor's Hammer ( Fiction) Level 14 Fast Forward Green: Time Travel: Ship Ahoy! ( Fiction) Level 13 Fast Forward Green: Time Travel: When in Rome ( Fiction) Level 13 Fast Forward Green: Water World ( Non-fiction) Level 12 Fast Forward Orange: Acting the Part ( Non-fiction) Level 16 Fast Forward Orange: A Very Long Journey ( Non-fiction) Level 15 Fast Forward Orange: Bonnie's Game ( Fiction) Level 16 Fast Forward Orange: Company Business ( Fiction) Level 15 Fast Forward Orange: Dad's Trick ( Fiction) Level 15 Fast Forward Orange: Everything is Changing ( Fiction) Level 15 Fast Forward Orange: Global Warming ( Non-fiction) Level 15 Fast Forward Orange: Heating Up ( Non-fiction) Level 15 Fast Forward Orange: Making Movies ( Non-fiction) Level 16 Fast Forward Orange: Marty and the Magazine ( Fiction) Level 15 Fast Forward Orange: Mercury and the Woodcutter ( Fiction) Level 16 Fast Forward Orange: Natural Partners ( Non-fiction) Level 15 Fast Forward Orange: New Tricks ( Fiction) Level 16 Fast Forward Orange: Scary Movie ( Fiction) Level 16 Fast Forward Orange: Simple Machines ( Non-fiction) Level 16 Fast Forward Orange: Teacher's Guide CD- ROM Level 15 Fast Forward Orange: Teacher's Guide CD- ROM Level 16 Fast Forward Orange: The Changing Map ( Non-fiction) Level 16 Fast Forward Orange: The Golden Touch ( Fiction) Level 15 Fast Forward Orange: The Space Race ( Non-fiction) Level 15 Fast Forward Orange: The Story of Hollywood ( Non-fiction) Level 16 Fast Forward Orange: UFO: Ordinary or Aliens? ( Non-fiction) Level 15 Fast Forward Orange: Unusual Hobbies ( Non-fiction) Level 16 Fast Forward Orange: Wait and See ( Fiction) Level 16 Fast Forward Orange: Walking on the Moon ( Non-fiction) Level 15 Fast Forward Orange: Wheels ( Non- Fiction) Level 16 Fast Forward Purple: All Shook Up ( Fiction) Level 19 Fast Forward Purple: Building the Pyramids ( Non-fiction) Level 20 Fast Forward Purple: Buzz Sees the Difference ( Fiction) Level 19 Fast Forward Purple: Dirt on My Shoe ( Fiction) Level 20 Fast Forward Purple: Experimenting With Magnets ( Non-fiction) Level 19 Fast Forward Purple: Famous Pharaohs ( Non-fiction) Level 20 Fast Forward Purple: Gadget Boy and Kid Fantastic ( Fiction) Level 20 Fast Forward Purple: Garbage ( Non-fiction) Level 19 Fast Forward Purple: Getting the Picture ( Non-fiction) Level 20 Fast Forward Purple: Life in Ancient Egypt ( Non-fiction) Level 20 Fast Forward Purple: Life in Ancient Rome ( Non-fiction) Level 19 Fast Forward Purple: Making Headlines ( Fiction) Level 20 Fast Forward Purple: People Underground ( Non-fiction) Level 19 Fast Forward Purple: Pompeii ( Non-fiction) Level 19 Fast Forward Purple: Teacher's Guide CD- ROM Level 19 Fast Forward Purple: Teacher's Guide CD- ROM Level 20 Fast Forward Purple: The Beginnings of Democracy ( Non-fiction) Level 20 Fast Forward Purple: The Coat ( Fiction) Level 20 Fast Forward Purple: The Giant's Causeway ( Fiction) Level 19 Fast Forward Purple: The Great Depression ( Non-fiction) Level 20 Fast Forward Purple: The Green Belt Movement ( Non-fiction) Level 19 Fast Forward Purple: Trapped ( Fiction) Level 19 Fast Forward Purple: Venus Bay ( Fiction) Level 19 Fast Forward Purple: Volcanoes ( Non-fiction) Level 19 Fast Forward Purple: Wind Power ( Non-fiction) Level 20 Fast Forward Purple: You Never Know ( Fiction) Level 20 Fast Forward Silver: Aztec Beliefs ( Non-fiction) Level 23 Fast Forward Silver: Bruno's Tea ( Fiction) Level 23 Fast Forward Silver: Danny's Dream ( Fiction) Level 24 Fast Forward Silver: Discovering Chemistry ( Non-fiction) Level 24 Fast Forward Silver: Discovering Metals ( Non-fiction) Level 23 Fast Forward Silver: Forces in Action ( Non-fiction) Level 23 Fast Forward Silver: Gladiators ( Non-fiction) Level 23 Fast Forward Silver: Goal! ( Fiction) Level 23 Fast Forward Silver: It's a Jungle Out There ( Fiction) Level 23 Fast Forward Silver: Living in Space ( Non-fiction) Level 24 Fast Forward Silver: Lizzie's Hidden Message ( Fiction) Level 23 Fast Forward Silver: My Best Friend Thinks I'm a Genius ( Fiction) Level 24 Fast Forward Silver: Noah's Secret ( Fiction) Level 23 Fast Forward Silver: People Have Their Say ( Non-fiction) Level 23 Fast Forward Silver: Race to the South Pole ( Non-fiction) Level 24 Fast Forward Silver: Shipwreck ( Fiction) Level 24 Fast Forward Silver: Space Tourism ( Non-fiction) Level 24 Fast Forward Silver: Teacher's Guide CD- ROM Level 23 Fast Forward Silver: Teacher's Guide CD- ROM Level 24 Fast Forward Silver: The Contest ( Fiction) Level 23 Fast Forward Silver: The European Union ( Non-fiction) Level 24 Fast Forward Silver: The Great Pharaoh's Secret Box ( Fiction) Level 24 Fast Forward Silver: The House of Wisdom ( Non-fiction) Level 24 Fast Forward Silver: The Ideas and Beliefs of Ancient Greece ( Non-fiction) Level 23 Fast Forward Silver: Twins ( Non-fiction) Level 23 Fast Forward Silver: Underground Rescue ( Non-fiction) Level 24 Fast Forward Turquoise: Animal Travellers ( Non-fiction) Level 18 Fast Forward Turquoise: Battle of the Bands ( Fiction) Level 17 Fast Forward Turquoise: Beginnings ( Non-fiction) Level 18 Fast Forward Turquoise: Diary of a Twister Chaser ( Non-fiction) Level 18 Fast Forward Turquoise: Drugs in Sport ( Non-fiction) Level 17 Fast Forward Turquoise: Fish ( Non-fiction) Level 17 Fast Forward Turquoise: Fossil Fuels ( Non-fiction) Level 17 Fast Forward Turquoise: Gadget Boy Saves the Day ( Fiction) Level 17 Fast Forward Turquoise: Glacier ( Fiction) Level 18 Fast Forward Turquoise: Great Plague of London ( Non-fiction) Level 18 Fast Forward Turquoise: Helping Out ( Non-fiction) Level 17 Fast Forward Turquoise: Inside the Gate ( Fiction) Level 17 Fast Forward Turquoise: Lucky Break ( Fiction) Level 18 Fast Forward Turquoise: Medieval Medical Care ( Non-fiction) Level 18 Fast Forward Turquoise: Renovations ( Fiction) Level 17 Fast Forward Turquoise: Saving Coral Reefs ( Non-fiction) Level 17 Fast Forward Turquoise: Small Pox ( Non-fiction) Level 18 Fast Forward Turquoise: Teacher's Guide CD- ROM Level 17 Fast Forward Turquoise: Teacher's Guide CD- ROM Level 18 Fast Forward Turquoise: The African Grasslands ( Non-fiction) Level 17 Fast Forward Turquoise: The Bully ( Fiction) Level 18 Fast Forward Turquoise: The Graveyard Shift ( Fiction) Level 18 Fast Forward Turquoise: The Great Barrier Reef ( Non-fiction) Level 17 Fast Forward Turquoise: The Inventors' Club Meets Again ( Fiction) Level 18 Fast Forward Turquoise: World Heritage ( Non-fiction) Level 18 Fast Forward Turquoise: You Wish! ( Fiction) Level 17 Fast Forward Yellow: A Night Out ( Fiction) Level 7 Fast Forward Yellow: Animal Disguises ( Non-fiction) Level 8 Fast Forward Yellow: Animal Groups ( Non-fiction) Level 6 Fast Forward Yellow: Animal Habitats ( Non-fiction) Level 6 Fast Forward Yellow: Animal Senses ( Non-fiction) Level 6 Fast Forward Yellow: At the Shops ( Non-fiction) Level 6 Fast Forward Yellow: Ben Fox Saves the Day ( Fiction) Level 6 Fast Forward Yellow: Bridges ( Non-fiction) Level 7 Fast Forward Yellow: Dad and Dan Go Fishing ( Fiction) Level 6 Fast Forward Yellow: Different Cultures, Different Foods ( Non-fiction) Level 7 Fast Forward Yellow: Escape from the Cyclops ( Fiction) Level 8 Fast Forward Yellow: Food from the World ( Non-fiction) Level 6 Fast Forward Yellow: Harry Helps Out ( Fiction) Level 7 Fast Forward Yellow: Hot and Cold ( Non-fiction) Level 8 Fast Forward Yellow: Ice on Earth ( Non-fiction) Level 7 Fast Forward Yellow: Making a Cake ( Non-fiction) Level 8 Fast Forward Yellow: Move It! ( Non-fiction) Level 6 Fast Forward Yellow: Noises in the Night ( Fiction) Level 6 Fast Forward Yellow: Skateboarding ( Non-fiction) Level 7 Fast Forward Yellow: Snail Farms ( Non-fiction) Level 8 Fast Forward Yellow: Surfing ( Non-fiction) Level 7 Fast Forward Yellow: Taking Off ( Fiction) Level 8 Fast Forward Yellow: Teacher's Guide CD- ROM Level 6 Fast Forward Yellow: Teacher's Guide CD- ROM Level 7 Fast Forward Yellow: Teacher's Guide CD- ROM Level 8 Fast Forward Yellow: The Jewellery Store Robbery ( Fiction) Level 8 Fast Forward Yellow: The Mess ( Fiction) Level 7 Fast Forward Yellow: The Mystery of the Missing Bike ( Fiction) Level 8 Fast Forward Yellow: The Very Hungry Mosquito ( Fiction) Level 6 Fast Forward Yellow: Tiger! ( Fiction) Level 7 Fast Forward Yellow: Understanding Rules ( Non-fiction) Level 8 Fast Forward Yellow: Wet and Dry ( Non-fiction) Level 8 Fast Forward Yellow: What's the Time? ( Non-fiction) Level 7 Engage your less confident readers and improve reading attainment with Fast Forward. This series offers a wide range of age-appropriate, high-interest readers for children in Key Stage 2 and 3 who are struggling to make progress with their reading. Each book has been carefully levelled to ensure steady progression with a range of text types introduced which children can use as a model for their own writing. #ffpacks #ff-easy-buy #sep-reading-schemes #pm19-offer
ISBN: 9789999513067
Review this product
 
Scholastic
Review this store
Scholastic
Product ID: 106081
 
£2032.94
 
Shop best deal

Murder/Mystery 7951 to 7973 of 7973 First | Previous | 262 | 263 | 264 | 265 | 266 | Next | Last